Features of Codon

Q.

What are codon and anticodon?

Q.

Is genetic code universal?

Q. What would happen, if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA?

1. A polypeptide of 49 amino acids will be formed
2. A polypeptide of 25 amino acids will be formed
3. A polypeptide of 24 amino acids will be formed
4. Two polypeptides of 24 and 25 amino acids will be formed

Q.

How many codons code for amino acids and how many are unable to do so?

Q. Nonsense codon takes part in

1. Terminating the process of protein synthesis
2. Formation of unspecified amino acids
3. Releasing tRNA from polypeptide chain
4. Conversion of sense DNA into nonsense one

Q.

What are 3 bases on the mRNA called?

Q.

61 codons out of 64 code for 20 different amino acids. What is it referred to as?

1. Overlapping of genes

2. Degeneracy of genetic code

3. Wobbling of codon

4. University of codons

Q. A group of three bases in a strand of mRNA that code for amino acids are called .

1. anticodons
2. nitrogenous bases
3. nucleosides
4. codons

Q. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?

1. AUGUUAAUAGACGAGUAGCGACGAUGU
2. AUGAGACGGACUGCAUUCCCAACCUGA
3. AUGCCCAACCGUUAUUCAUGCUAG
4. AUGUCGACAGUCUAAAACAGCGGG

Q. Which of the following microbial products is used as a ‘clot buster'? [1 mark]

1. Streptokinase
2. Cyclosporin A
3. Statin
4. Lipase

Q. (a) Describe the process of transcription in bacteria.

(b) Explain the processing the hnRNA which needs to undergo before becoming functional mRNA eukaryotes. [5]

Q. Which is the smallest gene present on human DNA and which protein is formed by it?

Q. Termination of polypeptide chain formation is brought about by

1. UUG, UAG, UCG
2. UAA, UAG, UGA
3. UUG, UGC, UCA
4. UCG, GCG, ACC

Q. UAA, UAG and UGA are known ascodons.

1. coding
2. start
3. stop
4. initiator

Q. Which of the following scientists developed a method of removing the plasmids from the cell and then reinserting them in other cells?

1. Herbert Boyer
2. Stanley Cohen
3. Both a and b
4. Sir Alec Jeffreys

Q. The number of codons coding for the 20 known amino acids is

1. 61
2. 64
3. 60
4. 67

Q. Which one is not the nonsense codon?

1. UAA
2. UGA
3. UCA
4. UAG

Q. A bacterial cell was transformed with a recombinant DNA molecule that was generated using a human gene. However, the transformed cells did not produce the desired protein. Reasons could be:

Q. Differentiate between the genetic codes given below:

(a) Unambiguous and Universal.

(b) Degenerate and Initiator. [2]

Q.

What occurs during translation?

Q. Which of the following pair of amino acids is specified by a single codon?

1. UUU (phenylalanine) and CGU (arginine)
2. GUG (valine) and GCU (alanine)
3. UAC (tyrosine) and UGG (tryptophan)
4. UGG (tryptophan) and AUG (methionine)

Q. Name 20 naturally occurring bases

Q. Who discovered genetic code?

1. Nirenberg
2. Khorana
3. Ochoa
4. Crick

Q.

Why ATG is a start codon?

Q. Identify a, b, c.

1. (a) Elongation, (b) Termination, (c) Initiation
2. (a) Initiation, (b) Termination, (c) Elongation
3. (a) Initiation, (b) Elongation, (c) Termination
4. (a) Termination, (b) Elongation, (c) Initiation

Q. The first codon discovered by Nirenberg and Matthaei was

1. UUU
2. AAA
3. GGG
4. CCC

Q.

Who proposed the double helix structure of DNA and when?

1. Watson and Crick, 1953

2. Hershey and Chase, 1952

3. Avery, McCarty and MacLeod, 1944

4. Griffith, 1928

Q. A technology which has found immense use in solving cases of disputed parentage is

1. Polymerase chain reaction
2. Monoclonal antibody production
3. Recombinant DNA technology
4. DNA finger printing

Q. What is Thymine Dimer?

Q. Out of 64 codons, 61 code for 20 types of amino acids. It is due to

1. Universality of codons
2. Degeneracy of genetic code
3. Wobbling of codons
4. Unambiguous nature of code