Question

A portion of a gene was sequenced in two individuals. What type of mutation has occurred in individual two?
Individual I:
mRNA: $AUGACUCACCGAGCGCGAAGCUGA$
Protein: $Met-Thr-His-Arg-Ala-Arg-Ser-Stop$

Individual II:
mRNA: $AUGACUCACUGAGCGCGAAGCUGA$
Protein: $Met-Thr-His-Stop$

• A. Frame-shift
• B. Deletion
• C. Silent
• D. Non-sense

Answer 1

The correct option is D Non-sense

• Frame-shift mutation is a mutation caused by the insertion or deletion of one or multiple nucleotides in the coding DNA resulting in the change in reading frame of genetic code.
• Deletion is a kind of mutation where one or multiple nucleotides are removed from the coding DNA.
• Silent mutation is a mutation in which a nucleotide base is substituted by other in coding region that resulting in non change of either translated aminoacid or aminoacid functionality, and thus the protein coded by mutated gene is functionally similar to the wild-type protein.
• Non-sense mutation is a base-substitution mutation, where a nucleotide base within the coding region is substituted by some other base causing its respective aminoacid coding codon to change to a stop codon, thus resulting mutated DNA code for a shorter, incomplete protein.

Here in the Individual II, a 'C to U' base-substitution happens in the 10th position of aminoacid resulting in a premature stop codon in the position of 4th aminoacid (Arg in Individula I). This is a classical example of "non-sense mutation".

Thus, the correct option is "(D) Non-sense".