In DNA, if one of the strands' direction is 5-3, the direction of the other strand is:

5-3

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5- 5

No worries! We‘ve got your back. Try BYJU‘S free classes today!

3-3

No worries! We‘ve got your back. Try BYJU‘S free classes today!

3-5

Right on! Give the BNAT exam to get a 100% scholarship for BYJUS courses

Open in App

Solution

The correct option is D 3-5
The two strands of DNA are anti-parallel.
One of the strands runs along 5'-3' direction and the other strand runs along 3'-5' direction.

Suggest Corrections

Similar questions

Q. If the sequence of one strand of DNA is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'

\to

3' direction.

If the sequence of one strand of DNA is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Q. Assertion :Synthesis of daughter or new strand occurs continuously along the parent 3

\to

5 strand. Reason: DNA polymerase can polymerise nucleotides in 3

\to

5 direction on 5

\to

3 strand.

Q. Which among the following statements is/are correct?

Statement 1: In the double-stranded DNA, only one strand serves as a template for the duplication of the new DNA.

Statement 2: Leading strand is continuously synthesised in 5’-3’ direction and lagging strand is discontinuously synthesised in 3’-5’ direction.

Statement 3: DNA polymerase reads the template strand in 5’-3’ direction.

Statement 4: Replication proceeds only in 5’-3’ direction

Choose the correct option

Q. One strand of DNA has sequence of nucleotide 3 ‘ATTCGCTAT 5’ then other strand of DNA has

Join BYJU'S Learning Program

In DNA, if one of the strands' direction is 5-3, the direction of the other strand is:

The correct option is D 3-5The two strands of DNA are anti-parallel.One of the strands runs along 5'-3' direction and the other strand runs along 3'-5' direction.

The correct option is D 3-5
The two strands of DNA are anti-parallel.
One of the strands runs along 5'-3' direction and the other strand runs along 3'-5' direction.