What Is the 3 Prime End of DNA?

Open in App

Solution

DNA:
Deoxyribonucleic acid is made up of phosphate group, sugar, and nitrogenous bases.
It is a double helical structure consisting of two antiparallel strands which are complementary to each other.
Each strand has a 5' end and a 3' end.
3' prime end consists of hydroxyl group and third carbon of the sugar.

Suggest Corrections

Similar questions

If the sequence of one strand of DNA is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write down the sequence of complementary strand in 5'→3' direction

If the sequence of one strand of DNA is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Q. DNA ligase joins 3' end of one DNA strand to the 5' end of another DNA strand.

Q. Given below is a short sequence of DNA describing the base pairs on each strand of DNA. What is so special about it?
5’___ GAATTC ___ 3’
3’ ___ CTTAAG ___ 5’

Q. Choose the correct sequence of the complimentary DNA strand produced as a result of replication of the given DNA strand.

3^{'} - A T G C T G A A C T - 5^{'}

Join BYJU'S Learning Program