Which of the following DNA sequences qualifies to be designated as a palindrome?

5'-GACCAG-3' in one strand

No worries! We‘ve got your back. Try BYJU‘S free classes today!

3'-GACCAG-5' in one strand

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5'-GACCAG-3' 3'-CTGGTC-5'

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5'-AGCGCT-3' 3'-TCGCGA-5'

Right on! Give the BNAT exam to get a 100% scholarship for BYJUS courses

Open in App

Solution

The correct option is B 5'-AGCGCT-3' 3'-TCGCGA-5'
When reading the DNA strand from 5' (five-prime) to 3' (three prime) on one strand matches the sequence reading 5' to 3' on the complementary strand with which it forms a double helix is same is called as the pallindromic sequence in DNA strand.
Thus, the correct answer is option D.

Suggest Corrections

Similar questions

If the sequence of one strand of DNA is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Q. In a double stranded DNA, the sequence of nucleotides in one strand is 3' ATTCGCTAT 5'. What will be the complementary sequence on the other strand?

Q. One strand of DNA has sequence of nucleotide 3 ‘ATTCGCTAT 5’ then other strand of DNA has

One strand of DNA has the following sequence of nucleotide 3’ATTCGCTAT5’ so the other strand of DNA has:

Q. If one strand, of double stranded DNA, consists of the sequence 3'-ATTCGTAC-5', then the complementary sequence must be

Join BYJU'S Learning Program