Which one of the following is the complementary sequence for the DNA sequence 5’ – CGTACTA – 3’

5’ – TAGTACG – 3’

Right on! Give the BNAT exam to get a 100% scholarship for BYJUS courses

5’ – ATCATGC – 3’

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5’ – UTCUTGC – 3’

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5’ – GCUAGCA – 3’

No worries! We‘ve got your back. Try BYJU‘S free classes today!

Open in App

Solution

The correct option is A 5’ – TAGTACG – 3’
To get the complementary sequence, the template has to be read from the 3' end. So, the complementary sequence will be:

5’ – TAGTACG – 3’

Suggest Corrections

Similar questions

Q. Which one of the following is the complementary sequence for the DNA with

5^{'}

-CGTACTA-

3^{'}

Q. Which of the following is complementary to the DNA sequence 5' ATTGCACCGG 3' ?

Q. For the given DNA sequence, the complementary mRNA sequence is given as below

5^{'} C G T A C G T A 3^{'}

Q. What will be the complementary RNA sequence for the following DNA sequence?
5' AATGCCTTAAGC 3'

If the sequence of one strand of DNA is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Join BYJU'S Learning Program

Which one of the following is the complementary sequence for the DNA sequence 5’ – CGTACTA – 3’

The correct option is A 5’ – TAGTACG – 3’ To get the complementary sequence, the template has to be read from the 3' end. So, the complementary sequence will be: 5’ – TAGTACG – 3’

The correct option is A 5’ – TAGTACG – 3’
To get the complementary sequence, the template has to be read from the 3' end. So, the complementary sequence will be:

5’ – TAGTACG – 3’