There is a convention in defining the two strands of the DNA in the
structural gene of a transcription unit. Since the two strands have
opposite polarity and the DNA-dependent RNA polymerase also catalyse the
polymerisation in only one direction, that is, 5′ to 3′.
The
strand that has the polarity 3′ to 5′ acts as a template, and
is also referred to as template strand. The other strand which has the
polarity (5′ to 3′) and the sequence same as RNA (except thymine
at the place of uracil), is displaced during transcription. Strangely,
this strand (which does not code for anything) is referred to as coding
strand.
All the reference point while defining a transcription unit
is made with coding strand. To explain the point, a hypothetical
sequence from a transcription unit is represented below:
3′−ATGCATGCATGCATGCATGCATGC−5′ Template Strand
5′−TACGTACGTACGTACGTACGTACG−3′ Coding Strand
A transcription unit in DNA is defined primarily by the three regions in the DNA:
(i) A Promoter
(ii) The Structural gene
(iii) A Terminator