can we take 3' to 5' strand as a coding strand in transcription unit

Open in App

Solution

Dear Student,

No, the coding strand is taken in 5'-3' direction only.

Regards,

Suggest Corrections

Similar questions

The strand of DNA acting as template for mRNA transcription is

(a) Coding strand (b) Noncoding strand (c) Sense strand (d) Antisense strand. The correct answer is

Q. Which defines the position and presence of template and coding strands in transcription unit

If the sequence of the coding strand in a transcription unit is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of mRNA.

Q. Write polarity of template strand and coding strand. Write three regions of transcription unit of DNA.

Q. Transcription occurs in which strand?either template strand or coding strand

Join BYJU'S Learning Program

can we take 3' to 5' strand as a coding strand in transcription unit

Dear Student, No, the coding strand is taken in 5'-3' direction only. Regards,

Dear Student,

No, the coding strand is taken in 5'-3' direction only.

Regards,