Choose the correct answer from the alternatives given :
Direction : Read the sequence of nucleotides in the given segment of mRNA and the respective amino acid sequence in the polypeptide chain to answer the Q. nos. 65 and 66.
mRNA AUGUUUAUGCCUGUUUCUUAA→
Polypeptide Met-Phe-Met-Pro-Val-Ser
Which codons respectively code for proline and valine amino acids in the given polypeptide chain, respectively?