Choose the correct sequence of the complimentary DNA strand produced as a result of replication of the given DNA strand.
$3^{'} - A T G C T G A A C T - 5^{'}$

5^{'} - A T G C T G A A C T - 3^{'}

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5^{'} - C G T A G T C C A G - 3^{'}

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5^{'} - G A C C T G A T G C - 3^{'}

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5^{'} - G C A T C A G G T C - 3^{'}

No worries! We‘ve got your back. Try BYJU‘S free classes today!

5^{'} - T A C G A C T T G A - 3^{'}

Right on! Give the BNAT exam to get a 100% scholarship for BYJUS courses

Open in App

Solution

The correct option is E $5^{'} - T A C G A C T T G A - 3^{'}$
DNA replication follows complimentary base pairing wherein A is paired with T and G with C. Replication of template DNA strand with sequence 3' ATGCTGAACT-5' would produce the complimentary strand with sequence 5’-TACGACTTGA-3’. Thus, the correct answer is option E.

Suggest Corrections

Similar questions

Q. The given segment of parental DNA is undergoing replication.
5’ AATCGCTTTAAAC 3’
3’ TTAGCGAAATTTG 5’
Predict the sequence of the newly synthesized daughter strands.

Q. Which among the following statements is/are correct?

Statement 1: In the double-stranded DNA, only one strand serves as a template for the duplication of the new DNA.

Statement 2: Leading strand is continuously synthesised in 5’-3’ direction and lagging strand is discontinuously synthesised in 3’-5’ direction.

Statement 3: DNA polymerase reads the template strand in 5’-3’ direction.

Statement 4: Replication proceeds only in 5’-3’ direction

Choose the correct option

If the sequence of one strand of DNA is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Q. One strand of DNA has sequence of nucleotide 3 ‘ATTCGCTAT 5’ then other strand of DNA has

Q. One strand of DNA has sequence of nucleotides 3' ATTCGCTAT 5’, then other strand of DNA has

Join BYJU'S Learning Program

Choose the correct sequence of the complimentary DNA strand produced as a result of replication of the given DNA strand.3′−ATGCTGAACT−5′

Choose the correct sequence of the complimentary DNA strand produced as a result of replication of the given DNA strand.
$3^{'} - A T G C T G A A C T - 5^{'}$