If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

Open in App

Solution

According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’. So, the sequence of the complimentary strand in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’.

Suggest Corrections

Similar questions

If the sequence of one strand of DNA is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.

If the sequence of the coding strand in a transcription unit is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of mRNA.

If the sequence of coding strand in transcription is as follows:
5’- ATGCATGCATGCATGCATGCATGCATGC - 3’

Write down the sequence of mRNA. [2]

Q. If one strand, of double stranded DNA, consists of the sequence 3'-ATTCGTAC-5', then the complementary sequence must be

Q. If the base sequence in one strand of double stranded DNA is 3′ TGATCAT 5′, then the base sequence of its complementary strand would be
[0.7 mark]

Join BYJU'S Learning Program

If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of complementary strand in 5'→ 3' direction.

According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’. So, the sequence of the complimentary strand in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’.

If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5' $\to$ 3' direction.