The sequence of coding strand of DNA in a transcription unit is $5^{'} -$ GGAATTCCG $- 3^{'}$ . What is the sequence of nucleotides of the following?
a) Its complementary strand
b) The mRNA.

Open in App

Solution

5′ - GGAATTCCG - 3′ - is the coding strand.
a) 3' - CCTTAAGGC - 5' - is the template strand (complementary strand).
b) 5' - GGAAUUCCG - 3' - is the mRNA.

Suggest Corrections

Similar questions

Q. 3'-AAATGCGCCATA-5’ is the sequence of nucleotides on a gene. After transcription the sequence of nucleotides in the mRNA formed from it and the sequence of nucleotides in the corresponding coding strand of DNA will be

During transcription, the nucleotide sequence of the DNA strand that is being coded is ATACG, then the nucleotide sequence in the mRNA would be

Q. During transcription, if the nucleotide sequence of the DNA strand that is being coded is ATACG, then the nucleotide sequence in the mRNA would be

Q. In a double stranded DNA, the sequence of nucleotides in one strand is 3' ATTCGCTAT 5'. What will be the complementary sequence on the other strand?

If the sequence of the coding strand in a transcription unit is written as follows
5' - ATGCATGCATGCATGCATGCATGCATGC - 3'
Write down the sequence of mRNA.

Join BYJU'S Learning Program

The sequence of coding strand of DNA in a transcription unit is 5′−GGAATTCCG−3′. What is the sequence of nucleotides of the following?a) Its complementary strandb) The mRNA.

5′ - GGAATTCCG - 3′ - is the coding strand.a) 3' - CCTTAAGGC - 5' - is the template strand (complementary strand).b) 5' - GGAAUUCCG - 3' - is the mRNA.

The sequence of coding strand of DNA in a transcription unit is $5^{'} -$ GGAATTCCG $- 3^{'}$ . What is the sequence of nucleotides of the following?
a) Its complementary strand
b) The mRNA.

5′ - GGAATTCCG - 3′ - is the coding strand.
a) 3' - CCTTAAGGC - 5' - is the template strand (complementary strand).
b) 5' - GGAAUUCCG - 3' - is the mRNA.