If the sequence of coding strand in transcription is as follows: 5’- ATGCATGCATGCATGCATGCATGCATGC - 3’
Write down the sequence of mRNA. [2]
Open in App
Solution
The template starnd would be complementary to the coding strand. Hence, template strand would be: [1] 3'- TACGTACGTACGTACGTACGTACGTACG - 5'
The sequence of the mRNA would be complementary to the template strand except T (thymine) would be replaced by U (uracil). Hence, the mRNA strand would be: [1] 5'- AUGCAUGCAUGCAUGCAUGCAUGCAUGC - 3'